Conversation

Notices

  1. Benjmin Hitchcock Benjmin Hitchcock

    The guts of my computer http://ur1.ca/a8704

    Friday, 14-Sep-12 02:01:51 UTC from web
    1. Toothpaste Pony! Toothpaste Pony!

      @shadowdash454 GIVE ME YOUR GFX CARD

      Friday, 14-Sep-12 02:02:27 UTC from web
      1. monsutaa kaado! monsutaa kaado!

        @minti this is funny because girl friend card

        Friday, 14-Sep-12 02:03:01 UTC from web
        1. Toothpaste Pony! Toothpaste Pony!

          @mushi GF != GFX. I wish they were the same, but they're not.

          Friday, 14-Sep-12 02:06:09 UTC from web
          1. monsutaa kaado! monsutaa kaado!

            @minti but what is a gfx?

            Friday, 14-Sep-12 02:07:19 UTC from web
      2. Caim Caim

        @minti Minti you gotta stop Carcino.

        Friday, 14-Sep-12 02:03:31 UTC from web
      3. Benjmin Hitchcock Benjmin Hitchcock

        @minti *holds it tight* YOU CANT HAVE IT

        Friday, 14-Sep-12 02:04:30 UTC from web
        1. Toothpaste Pony! Toothpaste Pony!

          @shadowdash454 ;_; TRADE YOU FOR MY GEFORCE 9400 GT

          Friday, 14-Sep-12 02:05:16 UTC from web
          1. Benjmin Hitchcock Benjmin Hitchcock

            @minti I have one those in my linux box lol

            Friday, 14-Sep-12 02:06:40 UTC from web
            1. Toothpaste Pony! Toothpaste Pony!

              @shadowdash454 It's the only card I have. xD

              Friday, 14-Sep-12 02:08:54 UTC from web
              1. Benjmin Hitchcock Benjmin Hitchcock

                @minti xD I was like for a while intill I got a job lol

                Friday, 14-Sep-12 02:20:14 UTC from web
                1. Toothpaste Pony! Toothpaste Pony!

                  @shadowdash454 I've been trying to get a job, but not knowing the primary language of the country you're in kind of makes it hard. XD

                  Friday, 14-Sep-12 02:26:39 UTC from web
                  1. Benjmin Hitchcock Benjmin Hitchcock

                    @minti well thats true xD

                    Friday, 14-Sep-12 02:27:30 UTC from web
                  2. Sir E. Hooves III Sir E. Hooves III

                    @minti Wait... You're in the French part of Canada?

                    Friday, 14-Sep-12 02:29:43 UTC from web
                    1. Toothpaste Pony! Toothpaste Pony!

                      @eaglehooves ... Quebec?

                      Friday, 14-Sep-12 02:30:10 UTC from web
                      1. Caim Caim

                        @minti http://ur1.ca/a87h8

                        Friday, 14-Sep-12 02:31:21 UTC from web
                        1. Toothpaste Pony! Toothpaste Pony!

                          @anarchycarcino ....... Lolol

                          Friday, 14-Sep-12 02:31:47 UTC from web
                          1. Caim Caim

                            @minti Hurry up and stop me.

                            Friday, 14-Sep-12 02:32:24 UTC from web
                            1. Toothpaste Pony! Toothpaste Pony!

                              @anarchycarcino AH TRYING. Where's Nerthos's help when you need him.

                              Friday, 14-Sep-12 02:33:19 UTC from web
                              1. Caim Caim

                                @minti I'll redo Captain America with an Argentina motif tomorrow.

                                Friday, 14-Sep-12 02:34:16 UTC from web
                              2. RDN's Lucifer RDN's Lucifer

                                @minti What do you need me for?

                                Friday, 14-Sep-12 02:41:04 UTC from web
                                1. Toothpaste Pony! Toothpaste Pony!

                                  @nerthos Help me catch Carcino.

                                  Friday, 14-Sep-12 02:41:34 UTC from web
                                  1. RDN's Lucifer RDN's Lucifer

                                    @minti Why do you want to catch Carino?

                                    Friday, 14-Sep-12 02:41:53 UTC from web
                                    1. RDN's Lucifer RDN's Lucifer

                                      @nerthos *carcino

                                      Friday, 14-Sep-12 02:42:10 UTC from web
                                      1. derps derps

                                        @nerthos ATCGGATCCCTATAGCATGATCGGATCCCTATAGCATACTAGGATTCAATACAAGACATTACATGGAGCATACTAGGATGGTCGATACAAGAGAGCATACTAGGATGGTCGATACAAGACATTACATGTACAAGACATTACATGGAGCATACTAGGATTCAATACAAGACATTACTACAAGACATTACATGGAGCATACTAGGATATTACATGGAGATGGAGCATACTAGGATGGTCGATACAAGACATTACATGTGAGCATACTAGGATGGTCGATACAAGACATTACATGGAGCATACTAGGATATTACATGGAGAGCATACTAGGATCATTACATGGAGCATACTAGGATTCAGGTCGATACACTAGGATAGACATTACATGGAGCATACTAGGATGGTCGATACAAGACATTACATGGAGCATACTAGGATTCAATACAAGACATTACTACAAGACATTACATGGAGCATACTAGGATATTACATGGAGATGGAGCATACTAGGATGGTCGATACAAGACATTACATGTGAGCATACTAGGATGGTCGATACAAGACATTACATGGAGCATACTAGGATATTACATGGAGAGCATACTAGGATGAGCATACTAGGATGGTCGATACAAGACATTACATGTGAGCATACTAGGATGGTCGATACAAGACATTACATGGAGCATACTAGGATATTACATGGAGAGCATACTAGGATATTACATGTGAGCATACTAGGATGGTCGATACAAGACATTACATGGAGCATACTAGGATATTACATGGAGAGTCAGGTCGATACA

                                        Friday, 14-Sep-12 02:45:55 UTC from MuSTArDroid
                                        1. RDN's Lucifer RDN's Lucifer

                                          @derps What's your damn problem.

                                          Friday, 14-Sep-12 02:46:25 UTC from web
                                          1. derps derps

                                            @nerthos Woof

                                            Friday, 14-Sep-12 02:46:35 UTC from MuSTArDroid
                                            1. Benjmin Hitchcock Benjmin Hitchcock

                                              @derps time to troubleshoot derps xD

                                              Friday, 14-Sep-12 02:49:25 UTC from web
                                          2. monsutaa kaado! monsutaa kaado!

                                            @nerthos DNA

                                            Friday, 14-Sep-12 02:46:44 UTC from web
                      2. Sir E. Hooves III Sir E. Hooves III

                        @minti Whatever it is. Your english seems fine...

                        Friday, 14-Sep-12 02:31:39 UTC from web
                        1. Toothpaste Pony! Toothpaste Pony!

                          @eaglehooves I don't know how to speak French. 90% of this area is French. :p

                          Friday, 14-Sep-12 02:32:41 UTC from web
                  3. A Big Pony A Big Pony

                    @minti you live in canada, don't you? they pretty much just need english

                    Friday, 14-Sep-12 02:32:19 UTC from MuSTArDroid
          2. Sir E. Hooves III Sir E. Hooves III

            @minti I'll offer you my 9800 GTX instead!

            Friday, 14-Sep-12 02:06:56 UTC from web
    2. RDN's Lucifer RDN's Lucifer

      @shadowdash454 Dat refrigeration.

      Friday, 14-Sep-12 02:11:11 UTC from web
      1. derps derps

        @nerthos NERTHOS

        Friday, 14-Sep-12 02:11:46 UTC from MuSTArDroid
        1. RDN's Lucifer RDN's Lucifer

          @derps DERPS

          Friday, 14-Sep-12 02:12:45 UTC from web
          1. derps derps

            @nerthos GET DOWN **** MONKEY SNIPERS

            Friday, 14-Sep-12 02:13:14 UTC from MuSTArDroid
            1. RDN's Lucifer RDN's Lucifer

              @derps What?

              Friday, 14-Sep-12 02:18:19 UTC from web
              1. derps derps

                @nerthos WE CAN GET THROUGH THIS MAN, JUST STAY AWAY FROM THE BAGEL

                Friday, 14-Sep-12 02:19:16 UTC from MuSTArDroid
                1. RDN's Lucifer RDN's Lucifer

                  @derps BUT I WANT THE BAGEL

                  Friday, 14-Sep-12 02:19:58 UTC from web
                  1. derps derps

                    @nerthos NO STOP. DON'T EAT BERT

                    Friday, 14-Sep-12 02:22:27 UTC from MuSTArDroid
                  2. derps derps

                    @nerthos STOP EATING BERT

                    Friday, 14-Sep-12 02:28:08 UTC from MuSTArDroid
                  3. derps derps

                    @nerthos STOP EATING BERT

                    Friday, 14-Sep-12 02:29:30 UTC from MuSTArDroid
                  4. derps derps

                    @nerthos STOP

                    Friday, 14-Sep-12 02:32:30 UTC from MuSTArDroid
          2. derps derps

            @nerthos MAN DOWN, I REPEAT, MAN DOWN

            Friday, 14-Sep-12 02:18:37 UTC from MuSTArDroid
      2. Benjmin Hitchcock Benjmin Hitchcock

        @nerthos I had to get to that water cooler since AMD processors like to get hot

        Friday, 14-Sep-12 02:28:20 UTC from web
        1. RDN's Lucifer RDN's Lucifer

          @shadowdash454 AMD processors behave. My 1100t never reached 50º

          Friday, 14-Sep-12 02:32:19 UTC from web
          1. Benjmin Hitchcock Benjmin Hitchcock

            @nerthos Mine is overclocked :D

            Friday, 14-Sep-12 02:33:28 UTC from web
            1. RDN's Lucifer RDN's Lucifer

              @shadowdash454 What for?

              Friday, 14-Sep-12 02:40:20 UTC from web
              1. Benjmin Hitchcock Benjmin Hitchcock

                @nerthos Because I like the power lol

                Friday, 14-Sep-12 02:46:49 UTC from web
                1. RDN's Lucifer RDN's Lucifer

                  @shadowdash454 That's just dumb. I mean, with my 1100t at factory settings, I never go over 40% of the CPU capacity.

                  Friday, 14-Sep-12 02:49:44 UTC from web
                  1. Benjmin Hitchcock Benjmin Hitchcock

                    @nerthos well not just the power I play alot high end games and I want to play on Ultra settings without losing to much FPS

                    Friday, 14-Sep-12 02:51:56 UTC from web
                    1. RDN's Lucifer RDN's Lucifer

                      @shadowdash454 I haven't yet found a "high end game" that used all the resources of my computer. Overclock is unnecesary.

                      Friday, 14-Sep-12 02:54:35 UTC from web
                      1. Benjmin Hitchcock Benjmin Hitchcock

                        @nerthos do you edit and render HD video?

                        Friday, 14-Sep-12 02:56:01 UTC from web
                        1. RDN's Lucifer RDN's Lucifer

                          @shadowdash454 Nope, not really my thing. I use this computer for games and internet.

                          Friday, 14-Sep-12 02:56:56 UTC from web
                      2. Sir E. Hooves III Sir E. Hooves III

                        @nerthos The only time I ever ran my CPU to 100% was actually for school. High-end mathematics program was running 100+ iterations of an approximation.

                        Friday, 14-Sep-12 02:56:51 UTC from web
          2. Creamsicle Badlands Creamsicle Badlands

            @nerthos I thought you may appreciate this. http://www.youtube.com/watch?v=Llk5Pq6aNUI&feature=g-u-u

            Friday, 14-Sep-12 02:39:45 UTC from web
            1. RDN's Lucifer RDN's Lucifer

              @wafers I'm trying not to buy another console, because I know I won't play enough with it to be worth the money.

              Friday, 14-Sep-12 02:43:18 UTC from web
              1. Creamsicle Badlands Creamsicle Badlands

                @nerthos I was thinking more along the lines of all the butthurt people.

                Friday, 14-Sep-12 02:44:23 UTC from web
                1. RDN's Lucifer RDN's Lucifer

                  @wafers Oh. Butthurt is a common ailment these days.

                  Friday, 14-Sep-12 02:44:52 UTC from web
                  1. Creamsicle Badlands Creamsicle Badlands

                    @nerthos undeniable

                    Friday, 14-Sep-12 02:46:41 UTC from web